1. /
  2. Коронавирус Вакцины
  3. /
  4. COVID19 – Свидетельства глобального...

COVID19 – Свидетельства глобального мошенничества

Автор: Иэн Дэвис /  17.12.2020.

COVID 19 и последующие меры правительства, похоже, являются частью международного заговора с целью совершения мошенничества. Похоже, нет никаких доказательств того, что вирус SARS-CoV-2 вызывает заболевание под названием COVID 19.

Иногда приходится действовать интуитивно. Я не специалист в области генетики, и если я ошибаюсь, то , как и всегда, прошу меня поправить. Однако мое внимание привлекли некоторые исследования, опубликованные испанским медицинским журналом D-Salud-Discovery. Их консультативный совет, состоящий из высококвалифицированных врачей и ученых, повышает доверие к их исследованиям. Их заявление поразительно.

Генетические праймеры и зонды, используемые в тестах ОТ-ПЦР для идентификации SARS-CoV-2, не нацелены ни на что конкретное. Я следовал методам поиска, описанным в этом английском переводе их отчета, и могу подтвердить точность их заявлений о нуклеотидных последовательностях, перечисленных в протоколах Всемирной организации здравоохранения. Вы можете сделать то же самое.

D-Salud-Discovery утверждает, что тестов, способных идентифицировать SARS-CoV-2, не существует. Следовательно, все утверждения о предполагаемом влиянии COVID 19 на здоровье населения безосновательны.

Вся официальная версия COVID 19 – обман. Якобы для любой его части нет научного обоснования.

Если эти утверждения верны, мы можем констатировать, что свидетельств пандемии нет, а есть лишь иллюзия. Мы понесли неисчислимые потери по непонятным причинам, кроме амбиций недобросовестных деспотов, которые хотят преобразовать глобальную экономику и наше общество в соответствии со своими целями.

Поступая так, этот  «класс паразитов»  потенциально совершил бесчисленное количество преступлений. Эти преступления могут и должны расследоваться и преследоваться в судебном порядке.


Всемирная организация здравоохранения (ВОЗ) классифицировала COVID-19 (COronaVIrus Disease 2019). 11 марта 2020 года объявили о глобальной пандемии COVID 19.

Руководство ВОЗ по лабораторным испытаниям гласит:

«Этиологический агент [причина заболевания], ответственный за кластер случаев пневмонии в Ухане, был идентифицирован как новый бета-коронавирус (в том же семействе, что и SARS-CoV и MERS-CoV) с помощью секвенирования следующего поколения (NGS) культивированного вируса или непосредственно из образцов, полученных от нескольких пациентов с пневмонией».

Притязания ВОЗ заключается в том, что вирус SARS-CoV-2  вызывает болезнь COVID-19. Они также утверждают, что этот вирус был четко идентифицирован исследователями из Ухани.

В отчете ВОЗ о ситуации с новым коронавирусом 2019-nCov 1 говорится:

«Китайские власти выявили новый тип коронавируса, который был изолирован 7 января 2020 года … 12 января 2020 года Китай поделился генетической последовательностью нового коронавируса, чтобы страны могли использовать его при разработке специальных диагностических наборов».

Эти два заявления ВОЗ четко предполагают, что вирус SARS-CoV-2 был изолирован (то есть очищен для исследования), а затем  в изолированном образце были идентифицированы генетические последовательности. На основе этого были разработаны и распространены по всему миру диагностические наборы для тестирования на вирус в городах и населенных пунктах по всему миру. По данным ВОЗ и китайских исследователей, эти тесты позволят обнаружить вирус, вызывающий COVID 19.

Тем не менее, ВОЗ также заявляет:

«Работая непосредственно с информацией о последовательностях, команда разработала серию анализов генетической амплификации (ПЦР), используемых в лабораториях».

Ученые из Ухани разработали свои анализы генетической амплификации на основе  «информации о последовательности»,  потому что не было изолированного очищенного образца так называемого вируса SARS-CoV-2. Они также показали электронные микроскопические изображения недавно обнаруженных вирионов (остроконечный белковый комок, содержащий вирусную РНК).

Однако такие белковые структуры не уникальны. Они выглядят так же, как и другие круглые везикулы, такие как эндоцитарные везикулы и экзосомы.

Вирусологи утверждают, что «изолировать»  вирус невозможно,  потому что он размножается только внутри клеток-хозяев. Они добавляют, что постулаты Коха неприменимы, потому что они относятся к бактериям (которые являются живыми организмами). Вместо этого вирусологи наблюдают цитопатогенные эффекты вируса (ЦПЭ), вызывающие мутации и деградацию клеток в культурах клеток.

Когда китайские исследователи впервые секвенировали полный геном SARS-CoV-2, они наблюдали CPE в клетках Vero E6 и Huh7. Vero E6 – это иммортализованная линия клеток обезьян, а Huh7 – иммортализованные раковые (онкогенные) клетки. Это означает, что они сохранялись in vitro (в культурах чашки Петри) в течение многих лет.

Центральное место в официальной истории SARS-CoV-2 занимает идея о том, что это зоонозный вирус, способный преодолеть разрыв между видами животных и людей. Когда ученые из CDC США  «заразили»  различные клетки новым вирусом, они отметили следующее:

«Мы исследовали способность SARS-CoV-2 инфицировать и реплицироваться в нескольких общих линиях клеток приматов и человека, включая клетки аденокарциномы человека (A549) [клетки легких], клетки печени человека (HUH7.0) и клетки эмбриональных почек человека ( HEK-293T), в дополнение к Vero E6 и Vero CCL81 [клетки обезьяны]… Никакого цитопатического эффекта не наблюдалось ни в одной из клеточных линий, кроме клеток Vero [клетки обезьяны]… Клетки HUH7.0 и 293T показали лишь умеренную вирусную репликацию и Клетки A549 [клетки легочной ткани человека] были несовместимы с инфекцией SARS-CoV-2».

CDC не обнаружил CPE в клетках человека. Они не видели доказательств того, что этот предполагаемый вирус вызвал какое-либо заболевание человека. Этот предполагаемый человеческий вирус также не демонстрировал заметной репликации в человеческих клетках, что предполагает невозможность инфицирования человека человеку.

Отмечая эту проблему, группа польских ученых представила этот упорядоченный «вирус» для человеческих epithethelium (дыхательные пути) клеток. Они наблюдали эффекты на этих культурах HAE в течение 5 дней. Они отметили гораздо большую репликацию, чем ученые CDC, но в конечном итоге заявили:

«Мы не наблюдали высвобождения вируса из базолатеральной стороны культуры HAE».

Это означает, что они не видели никаких доказательств того, что предполагаемые вирионы нарушают мембрану клеточной стенки. Снова предполагают, что этот так называемый вирус не заразен для людей.

Неясно, является ли SARS-CoV-2 вирусом человека, способным вызывать болезнь. Он может даже не существовать физически. Разве это не более чем концепция, основанная на предсказании генетических последовательностей?


Уханьский центр по контролю и профилактике заболеваний и Шанхайский клинический центр общественного здравоохранения опубликовали первый полный геном SARS-CoV-2 (MN908947.1). Это обновлялось много раз. Однако MN908947.1 была первой генетической последовательностью, описывающей предполагаемый этиологический агент COVID 19 (SARS-CoV-2).

Все последующие утверждения, тесты, методы лечения, статистика, разработка вакцины и результирующая политика основаны на этой последовательности. Если тесты на этот  новый  вирус не выявляют ничего, что могло бы вызвать болезнь у людей, весь рассказ о COVID 19 – ни что иное, как шарада.

Исследователи WUHAN заявили, что они эффективно соединили генетическую последовательность SARS-CoV-2, сопоставив фрагменты, обнаруженные в образцах, с другими, ранее обнаруженными генетическими последовательностями. Из собранного материала они обнаружили 87,1% совпадение с коронавирусом SARS (SARS-Cov). Они использовали сборку de novo и прицельную ПЦР и обнаружили 29 891 пару оснований, которые на 79,6% совпадали с последовательностью SARS-CoV.

Им пришлось использовать сборку de novo, потому что они не знали априори правильную последовательность или порядок этих фрагментов. Проще говоря, заявление ВОЗ о том, что китайские исследователи выделили вирус 7 января, является ложным.

Команда из Ухани использовала 40 раундов амплификации RT-qPCR для сопоставления фрагментов кДНК (комплементарная ДНК, построенная из фрагментов выборки РНК) с опубликованным геномом коронавируса SARS (SARS-CoV). К сожалению, неясно, насколько точен исходный геном SARS-CoV.

В 2003 году группа исследователей из Гонконга изучила 50 пациентов с тяжелым острым респираторным синдромом (SARS). Они взяли образцы у 2 из этих пациентов и создали культуру клеток печени эмбриона обезьяны.

Они создали 30 клонов найденного генетического материала. Не имея возможности найти доказательства какого-либо другого известного вируса, только в одном из этих клонированных образцов они обнаружили генетические последовательности «неизвестного происхождения».

Изучив эти неизвестные последовательности РНК, они обнаружили, что 57% совпадают с короновирусом крупного рогатого скота и вирусом гепатита мышей, и пришли к выводу, что он принадлежит к семейству Coronaviridae. Рассматривая эти последовательности, чтобы предположить недавно открытый вирус SARS-CoV (новые открытия – это амброзия для ученых), они разработали праймеры RT-PCR для тестирования этого нового вируса. Исследователи заявили:

«Праймеры для обнаружения нового вируса были разработаны для обнаружения генома этого человеческого коронавируса, связанного с пневмонией, в клинических образцах с помощью ОТ-ПЦР. Из 44 образцов носоглотки, полученных от 50 пациентов с SARS, 22 имели доказательства РНК коронавируса, ассоциированного с пневмонией».

Половина протестированных пациентов, у которых были одинаковые симптомы, дали положительный результат на этот новый предполагаемый вирус. Никто не знает, почему другая половина дала отрицательный результат на этот новый вирус SARS-CoV. Вопрос не был задан.

Этот предполагаемый вирус имел всего 57% совпадения последовательности с предположительно известным коронавирусом. Остальные 43% были просто «там». Секвенированные данные были получены и записаны как новый геном под номером доступа GenBank AY274119.

Впоследствии исследователи из Ухани обнаружили совпадение последовательности с AY274119 на 79,6% и поэтому назвали его новым штаммом SARS-CoV (2019-nCoV – в конечном итоге переименованный в SARS-CoV-2). Никто на любой стадии этого процесса не производил ни одного изолированного очищенного образца какого-либо вируса. Все, что у них было, это совпадение процентной последовательности с другими совпадениями процентной последовательности.


Ученые очень раздражены, потому что они продолжают говорить, что вирус изолирован, но им никто не верит. Это связано с тем, что до сих пор никто не предоставил ни одного очищенного образца вируса SARS-CoV-2. Вместо этого у нас есть законченный геном, и, как мы скоро обнаружим, он не особенно убедителен.

Журналисты-расследователи Торстен Энгельбрехт и Константин Деметер попросили некоторых ученых, которые сказали, что у них есть изображения вирионов SARS-C0V-2, подтвердить, что это изображения изолированного очищенного вируса. Никто из них не смог.

В Австралии ученые из Института Доэрти объявили, что изолировали вирус SARS-CoV-2. На просьбу уточнить, ученые ответили:

«У нас есть короткие (РНК) последовательности диагностического теста, которые можно использовать в диагностических тестах».

Это объясняет, почему правительство Австралии заявляет:

«Надежность тестов на COVID-19 сомнительна из-за ограниченной доказательной базы … Имеются ограниченные доказательства для оценки точности и клинической применимости имеющихся тестов на COVID-19».

В июле в Великобритании группа заинтересованных ученых написала письмо премьер-министру Великобритании Борису Джонсону, в котором просили его:

«Произвести независимую экспертную оценку научных доказательств, подтверждающих выделение вируса Covid-19». 
До сегодняшнего дня они не получили ответа.

Точно так же британский исследователь Эндрю Джонсон обратился с запросом о свободе информации в Общественное здравоохранение Англии (PHE). Он попросил их предоставить ему свои записи с описанием выделения вируса SARS-COV-2. На что они ответили:

«PHE может подтвердить, что не хранит информацию в соответствии с вашим запросом».

Канадский исследователь Кристин Мэсси обратилась с аналогичным запросом о свободе информации, прося о том же правительство Канады. На что канадское правительство ответило:

«Завершив тщательный поиск, мы с сожалением сообщаем вам, что нам не удалось найти какие-либо записи, отвечающие вашему запросу».

В США, в инструкции использования диагностической панели ОТ-ПЦР Центра по контролю заболеваний (CDC) говорится:

«… В настоящее время нет доступных количественных изолятов вируса 2019-nCoV …… .. Обнаружение вирусной РНК может не указывать на присутствие инфекционного вируса или на то, что 2019-nCoV является возбудителем клинических симптомов».

Последнее обновление 13 июля 2020 года, CDC еще не получил какой-либо чистый вирусный образец от какого-нибудь пациента, который, как утверждается, страдает заболеванием COVID-19. Они открыто признают, что их тесты не обязательно показывают, присутствует ли SARS-CoV-2 или вызывает COVID 19.

Нам говорят, что все это не имеет значения. Что мы невежественны и просто не разбираемся в вирусологии. Следовательно, мы должны принять изображения вещей, которые, как мы знаем, могут быть чем-то другим, и генетическими последовательностями (которые могут быть чем-то еще) как убедительное доказательство того, что этот вирус и болезнь, которую он должен вызывать, реальны.


ВОЗ и каждое правительство, аналитический центр, руководящий комитет по политике, правительственный научный советник, наднациональные учреждения и другие лица, продвигающие официальную версию COVID 19, утверждают, что SARS-CoV-2 вызывает COVID 19.

Хотя никто никогда не производил образец этого предполагаемого вируса, предполагаемый геном SARS-CoV-2 был опубликован. Это общественное достояние.

Говорят, что ключевые генетические последовательности в геноме SARS-CoV-2 выполняют определенные функции. Это целевые белки, которые ученые тестируют, чтобы определить присутствие «вируса». К ним относятся:

  • Ген РНК-полимеразы (Rd-Rp) – он позволяет РНК SARS-CoV-2 реплицироваться внутри цитоплазмы эпителиальных клеток, пораженных COVID 19.
  • Ген S (Orf2) – этот гликопротеин формирует шип на поверхности вириона SARS-CoV-2, который предположительно облегчает связывание SARS-CoV-2 с рецепторами ACE2 на клетках, позволяя РНК внутри оболочки белка вириона (капсида) переходить в теперь инфицированную клетку.
  • Ген E (Orf1ab) – небольшой мембранный белок, используемый в сборке вируса
  • Ген N (Orf9a) – ген нуклеокапсида, который связывает РНК при образовании капсида.

ВОЗ ведет общедоступную запись праймеров и зондов ОТ-ПЦР, используемых для тестирования на SARS-CoV-2. Праймеры представляют собой специфические нуклеотидные последовательности, которые связываются (отжигаются) с антисмысловой и смысловой цепями синтезированной кДНК (называемые прямым и обратным праймерами соответственно).

Нити кДНК разделяются при нагревании и реформируются при охлаждении. Перед охлаждением нуклеотидные последовательности, называемые зондами, вводятся для отжига в конкретных областях-мишенях предполагаемого вирусного генома. Во время амплификации, когда области между праймерами удлиняются, когда праймер ударяет по зонду, зонд распадается, высвобождая флуоресцентный краситель, который затем может быть прочитан исследователями.

Именно идентификация этих маркеров, по утверждениям ученых, доказывает присутствие SARS-CoV-2 в образце.

Еще кое-что, что является общедоступным, – это инструмент поиска базового локального выравнивания (BLAST). Это позволяет любому сравнивать опубликованные нуклеотидные последовательности со всеми теми, которые хранятся в генетической базе данных Национального института здравоохранения США (NIH) под названием GenBank. Таким образом, мы можем выполнить BLAST заявленные праймеры SARS-CoV-2, зонды и последовательности целевых генов.

Прямые, обратные праймеры и протоколы зондов ВОЗ для предполагаемого вирусного генома SARS-CoV-2 основаны на профилях генов RdRp, Orf1, N и E. Любой может запустить их через BLAST, чтобы увидеть, что мы находим.

Жизненно важная нуклеотидная последовательность RdRP, используемая в качестве прямого праймера, – ATGAGCTTAGTCCTGTTG. Если мы запустим нуклеотидный BLAST, он будет записан как полный изолят  SARS-CoV-2  со 100% совпадением последовательностей. Точно так же последовательность праймера обратного гена E – ATATTGCAGCAGTACGCACACA – выявляет присутствие последовательности Orf1ab, которая также  идентифицирует  SARS-CoV-2.

Однако BLAST также позволяет нам искать нуклеотидные последовательности микробного генома и генома человека. Если мы ищем последовательность RdRp SARS-CoV-2, она обнаруживает 99 хромосом человека со 100% совпадением последовательностей. Orf1ab (ген E) возвращает 90 при 100% совпадении последовательностей с хромосомами человека.

То же самое для этих последовательностей с помощью микробного поиска обнаруживает 92 микроба со 100% совпадением с геном SARS-CoV-2 E и 100 микробов со 100% идентичностью последовательностей с жизненно важным геном SARS-CoV-2 RdRp.

Всякий раз, когда мы проверяем так называемые уникальные генетические маркеры SARS-CoV-2, записанные в протоколах ВОЗ, мы обнаруживаем полные или высокие процентные совпадения с различными фрагментами генома человека. Это говорит о том, что генетические последовательности, которые должны идентифицировать SARS-CoV-2, не уникальны. Это может быть что угодно, от микробных последовательностей до фрагментов хромосом человека.

Так называемые специалисты по проверке фактов, такие как  проект Reuters Health Feedback, поспешили отклонить утверждения тех, кто заметил очевидное отсутствие специфичности в предполагаемом геноме SARS-CoV-2.

Используя множество соломенных аргументов, таких как  «это утверждение предполагает, что все тесты должны быть положительными»  (а это не так), их попытка опровержения работает примерно так.

Праймеры предназначены для связывания с конкретными нуклеотидными последовательностями, уникальными для вируса. Прямой праймер может связываться с определенной хромосомой, но обратный праймер не связывается с той же хромосомой, и поэтому хромосома не присутствует в вирусе SARS-CoV-2. Более того, поскольку прямой и обратный праймеры охватывают амплифицируемую последовательность, последовательность cDMA между праймерами уникальна для вируса.

Похоже, это намеренно искажает значение этих выводов, выдвигая аргумент, который никто, кроме самих проверяющих фактов, не выдвигает. Поиски BLAST показывают, что эти целевые последовательности не уникальны для SARS-CoV-2. Для того, чтобы результат был признан положительным, необязательно находить все цели.

Марокканские исследователи исследовали эпидемиологию предполагаемых марокканских  случаев  SARS-CoV-2. Девять процентов были положительными по трем генам, восемнадцать процентов были положительными по двум генам и семьдесят три процента – только по одному. Как мы только что обсуждали, многие из них не могли быть положительными.

Это полностью соответствует рекомендациям ВОЗ по тестированию. Они заявляют:

«Оптимальный диагноз состоит из NAAT [теста амплификации нуклеиновой кислоты] с минимум двумя геном-независимыми мишенями SARS-CoV-2; однако в регионах, где передача широко распространена, можно использовать простой алгоритм с одной целью …… Один или несколько отрицательных результатов не обязательно исключают заражение SARS-CoV-2».

Независимо от ложных аргументов хорошо финансируемых специалистов по проверке фактов, если прямой и обратный праймеры идентифицируют мусор, возможно, один является фрагментом хромосомы, а другой – микробной последовательностью, то амплифицированная область между ними, вероятно, тоже мусор.

Аргумент, что ОТ-ПЦР находит только РНК, надуман. Естественная транскрипция (разделение цепей ДНК) происходит во время экспрессии генов. Никто не говорит, что целые хромосомы или микробы секвенированы в предполагаемом геноме SARS-CoV-2. Хотя могут, насколько мы знаем. Они говорят, что предполагаемые маркеры, использованные для тестирования этого предполагаемого вируса, не подходят по назначению.

Тесты RT-PCR не секвенируют весь геном. Они ищут случаи цветения определенных зондов, чтобы указать на присутствие последовательностей, которые, как утверждается, существуют. Эти последовательности определены MN908947.1 и последующими обновлениями. Эти праймеры и зонды не могли выявить ничего, кроме совпадений РНК, извлеченных из некодирующей, иногда называемой «мусорной» ДНК (кДНК).

Например, ген SARS-CoV-2 S должен быть высокоспецифичным для генома вируса SARS-CoV-2. Целевая последовательность – TTGGCAAAATTCAAGACTCACTTTC. Микробный поиск BLAST возвращает 97 микробных совпадений со 100% совпадением идентичности последовательностей. Наименьшее совпадение процентного соотношения среди 100 лучших составляет 95%. Геном человека BLAST также обнаруживает 100% совпадение последовательностей с 86 фрагментами хромосом человека.

Независимо от того, где вы смотрите в предполагаемом геноме SARS-CoV-2, в протоколах испытаний ВОЗ нет ничего, что четко определяло бы, что это такое. Весь геном мог быть ложным. Тесты не доказывают существования SARS-CoV-2. Все, что они раскрывают, – это смесь из неопределенного генетического материала.

Если это так, поскольку нет изолятов или очищенных образцов вируса без жизнеспособного теста, нет никаких доказательств существования SARS-CoV-2. Следовательно, нет никаких доказательств существования заболевания под названием COVID 19.

Это означает, что нет никаких научных оснований для каких-либо заявлений о количестве случаев COVID 19, госпитализации или данных о смертности. Все меры, принимаемые для борьбы с этим  смертельным вирусом, вполне возможно, ни на чем не основаны.


Мошенничество – преступное деяние. 

Юридическое определение мошенничества: «Какая-то обманная практика или умышленное средство, к которым прибегли с намерением лишить другого человека его права или каким-либо образом причинить ему вред».

Юридическое определение заговора: «Объединение или конфедерация между двумя или более лицами, образованные с целью совершения их совместными усилиями какого-либо незаконного или преступного действия».

Похоже, те, кто утверждает, что мы сталкиваемся с пандемией, не представили никаких доказательств того, что вирус под названием SARS-CoV-2 вызывает заболевание под названием COVID 19. Вся информация, убедительно указывающая на такую ​​возможность, легко доступна в открытом доступе. Кто угодно может это прочитать.

Чтобы обман был обманом, он должен быть умышленным. Намерение должно заключаться в том, чтобы умышленно лишить других их прав или каким-либо иным образом причинить им вред. Если есть доказательства сговора между отдельными лицами и / или организациями с целью совершения мошенничества, то это сговор (в юрисдикциях общего права) или совместное преступное предприятие (JCE) в соответствии с международным правом.

Похоже, что COVID 19 преднамеренно использовался как  повод  для войны с человечеством. Мы были заключены в тюрьму в наших собственных домах, наша свобода передвижения ограничена, свобода слова и выражения подорвана, права на протест урезаны, разлучены с близкими, наши предприятия разрушены, психологически обстреляны, одели намордники и терроризируют.

Что еще хуже, хотя нет никаких доказательств беспрецедентной  смертности  от  всех причин, произошел неоправданный всплеск смертности. Они точно связаны с мерами блокировки, которые привели к прекращению оказания медицинских услуг, за которые мы платим, и переориентации услуг общественного здравоохранения на лечение одного предполагаемого заболевания в ущерб всем остальным.

Кроме того, те, кто опубликовал историю о COVID 19, предполагают, что это предполагаемое заболевание служит оправданием полной реструктуризации глобальной экономики, наших политических систем, обществ, культур и самого человечества.

Чтобы получить возможность участвовать в их так называемой «новой норме», которая является полной трансформацией всего нашего общества без нашего согласия, они настаивают на том, чтобы мы подчинялись их условиям.

К ним относятся, помимо прочего, биометрическое наблюдение за всеми, централизованный контроль и мониторинг всех наших транзакций, жесткие деловые и социальные ограничения и платежеспособное требование, согласно которому мы не имеем права на суверенитет над нашими собственными телами. Это составляет состояние рабства.

Нет сомнений в том, что мы были лишены прав и травмированы. В юрисдикциях общего права невиновность предполагается, но доказательств того, что вред был преднамеренно причинен международным заговором, неопровержимо. Деструктивная политика, проводимая правительствами по всему миру, явно зародилась в глобалистских аналитических центрах и наднациональных учреждениях задолго до возникновения этой несуществующей пандемии.

В юрисдикциях Кодекса Наполеона виновность предполагается. Чтобы обвиняемые в заговоре могли доказать свою невиновность, они должны показать, что, несмотря на свои неизмеримые ресурсы, они коллективно не смогли получить доступ или понять какие-либо свободно доступные доказательства, предполагающие, что COVID 19 является мифом.

Виновные в преступном сговоре с целью совершения глобального мошенничества должны предстать перед судом. Если они будут признаны виновными, они должны быть заключены в тюрьму, пока остальные из нас будут пытаться исправить ущерб, который они уже нанесли.

Источник: https://off-guardian.org/2020/11/17/covid19-evidence-of-global-fraud/

Материалы по теме:

И снова о пропавшем вирусе; они солгали и закрыли мир на карантин
Автор: Джон Раппопорт. / 13.10.2020г. У еще одного ключевого разработчика теста COVID PCR не оказалось доступа к образцам коронавируса; Выдуманная история о пандемии COVID рушится как ...
Сатира: инопланетное вторжение гномов истерия COVID-19
Автор: Джон К.А. Мэнли /  7.01.2021. Тема: Дезинформация СМИ. На заметку нашим читателям. Это сатира, посвященная «таинственным монолитам», которая, по мнению НАСА, «прокладывает путь к полномасштабному вторжению пришельцев».  *** В ...
Маски для лица: под угрозой наша планета, наши дети и мы сами
Автор: Кори Морнингстар. / 6.11.2020г. Кажется, только вчера была в тренде массовая компания против использования одноразовых пластиковых соломинок. Совершенно позабытое сейчас движение против использования соломинок основывалось ...
Скандал с тестированием на COVID-19 углубляется
18.12.2020. Положительные тесты полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) использовались в качестве оправдания для того, чтобы держать большую часть мира взаперти в течение последних ...
Путь тиранов
Автор: Джон Раппопорт. / 26 апреля 2020 г. Вот цитата из Американской революции 2.0:  «Распоряжения губернатора нарушают Конституцию США и сводят на нет ответственность отдельных граждан ...
Уведомить о
0 Комментарий
Межтекстовые Отзывы
Посмотреть все комментарии